Inactivation of human pancreatic ductal adenocarcinoma with atmospheric plasma treated media and water: a comparative study

The kINPen^® IND plasma jet (INP Greifswald/neoplas tools GmbH, Greifswald, Germany) was used. Detailed information about the design and operation of the kINPen^® IND plasma device was reported previously [2, 11]. Briefly, it houses two electrodes: a pin electrode (1 mm diameter) in the center that is separated by a dielectric capillary (1.6 mm inner diameter) from a grounded ring electrode. The plasma is generated by high frequency sinusoidal voltage of around 2–6 kVpp to the central electrode, with a frequency between 1.0 and 1.1 MHz and a maximum power of 3.5 W. To control the temperature, the device operates as a switch off and on mode with a frequency of 2.5 kHz. The plasma is created inside the capillary and creates a plasma effluent with a length of 9–12 mm from the 1 mm diameter with the gas flow towards the open side of the device [2, 11]. For the plasma treatments, we used argon gas (purity 99.9%) with a flow rate of 3 lpm, and we kept a 10 mm distance between the nozzle of the plasma jet device and the liquid surface [11]. Based on the literature [36, 37], the electron density of the kINPen^® IND plasma jet was in the order of 10¹² cm³, the power density was 1.5 W cm⁻³ and the gas temperature was in the range of 45 °C–50 °C. The optical emission spectra revealed excited argon peaks between 700 and 900 nm, nitrogen emission lines between 330 and 420 nm, as well as OH emission at 309 nm, using optical emission spectroscopy as reported previously [38].

To make the PTM and PTW, DI water or DMEM was treated with plasma for 3, 5 and 10 min in a 48-well plate. We analyzed the pH and H₂O₂/${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ concentrations in the plasma treated solutions, using the method described below. For the cell viability, apoptosis and gene expression, we used 10 min exposed PTM/PTW. After exposure, 300 µl of PTM/PTW remained of the initial 800 µl of culture media or water. Subsequently, we used different percentages, i.e. 50, 25, 12.5, 6.2, 3.1 and 1.5%, of the PTM or PTW, which we added to a 48-well plate, containing cells with untreated culture media. After addition of the respective percentages of PTM/PTW, the total volume was 500 µl per well. Next, we incubated the treated/non-treated cells for 24, 48 and 72 h. In this study, the abbreviations PTM/PTW-50, PTM/PTW-25, PTM/PTW-12.5, PTM/PTW-6.2, PTM/PTW-3.1 and PTM/PTW-1.5 will be used for the 50, 25, 12.5, 6.2, 3.1 and 1.5% of PTM/PTW (formed after 10 min plasma treatment), respectively.

To determine the pH of the solution after plasma exposure, DMEM and DI water were exposed to CAP for up to 10 min. Just after exposure, the pH of the PTM/PTW was measured using a pH meter (pHenomenalR pH 1100 H pH-meter (VWR)). The hydrogen peroxide (H₂O₂) concentrations in the medium and water were analyzed after CAP exposure at different time intervals using the titanyl ion as described previously [11], while the ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ concentration was measured using the Griess Reagent Nitrite Measurement kit (Cell Signaling Technology^®, 13547), as described previously [11].

The cytotoxicity of PTM/PTW on two types of pancreatic ductal adenocarcinomas (MiaPaca-2, BxPc3), and hPSC128-SV pancreatic stellate cells (PSCs) was evaluated. MiaPaca-2 and hPSC128-SV cells were maintained in DMEM supplemented with 10% FBS, 1% non-essential amino acids, 1% glutamine, 1% penicillin (100 IU ml⁻¹) and streptomycin (100 mg ml⁻¹) (all from Gibco^™ DMEM, Life Technologies), whereas Bxpc3 cells were cultured in RPMI supplemented with 10% FBS, 1% non-essential amino acids, 1% glutamine, 1% penicillin (100 IU ml⁻¹) and streptomycin (100 mg ml⁻¹) (all from Gibco^™ DMEM, Life Technologies). All cultures were maintained at 37 °C, 95% relative humidity and 5% CO₂. The cells were grown in 75 cm² tissue culture flasks until they reached confluence and were then sub-cultured for the experiments. 2–4  ×  10⁵ cells ml⁻¹ were seeded into 48-well plates to grow in complete media. PTM/PTW-50, PTM/PTW-25, PTM/PTW-12.5, PTM/PTW-6.2, PTM/PTW-3.1 and PTM/PTW-1.5 were added to each well, as described above, to obtain a final volume of 500 µl. We used equation (1), to calculate the concentration of H₂O₂ transfer to each well during the PTM/PTW treatment:

$$\begin{align} \newcommand{\e}{{\rm e}} \displaystyle \left[\left({\rm X}\%\times 300\,\mu {\rm l} \right)\times 1500\,\mu {\rm M} \right]\div 500\,\mu {\rm l}={\rm Y}\,\mu {\rm M}{\rm .}\nonumber \end{align} \tag{ 1 }$$

To check the cell viability, each plate was carefully rinsed with PBS. The viability was assessed using 50 µl MTT (3-[4,5-dimethylthiazol-2yl]-2,5-diphenyltetrazolium bromide) solutions (5 mg ml⁻¹ in PBS), which was added to each well in the plate, and the plates were incubated for 3 h. Following incubation, the medium was removed and the purple formazan precipitates in each well were released in the presence of 500 µl DMSO (dimethyl sulphoxide). The absorbance was measured using a microplate reader (BIO-RAD iMark Microplate reader) at 540 nm and the cell viability was assessed as the absorbance ratio between the PTM/PTW treated and control cells, which was directly proportional to the number of metabolically active cells.

Furthermore, the MiaPaca-2, BxPc3, and hPSC128-SV cells were exposed to PTM/PTW-12.5, to detect cell death using the Annexin V-FITC apoptosis detection kit (FITC Annexin V Apoptosis Detection Kit, BD Biosciences). The treated/untreated cells were washed with 1 ml of cold 1X binding buffer after a 3 h incubation, and were subsequently trypsinized. Annexin V-FITC (0.5 mg ml⁻¹) was added to each sample. After incubation for 15 min at room temperature, the cells were again washed with PBS and stained with 0.3 mg ml⁻¹ of PI (Propidium Iodide) and analyzed using flow cytometry (Attune NxT Flow Cytometer).

To investigate the total ROS content inside the cells, the CellROX^™ Green molecular probe was used. 3000 cells/well (96 well-plate) were exposed to PTM/PTW-12.5 with 50 µM CellROX^™ Green. We used real time measurements for 10 h using the IncuCyte ZOOM^® system control (Essen Bioscience) microplate reader.

To perform a quantitative evaluation of the expression of oxidative related genes, the total RNA content was isolated from the untreated and treated cells after a 3 h exposure with PTM/PTW-12.5, using the Purelink^™ RNA Mini kit (Ambion^®) according to the manufacturer's protocol. The RNA concentrations were measured using an Epoch Microplate Spectrophotometer (BioTek^®). Before Real-Time PCR, the RNA samples were treated with RQ1 Rnase-Free Dnase (1 unit µg⁻¹ RNA) (Promega©). cDNA was synthesized from 2 µg RNA, using the SuperScript^® II Reverse Transcriptase (Invitrogen^™). PCR reactions were performed using the Step One Plus^™ Real-Time PCR (Applied Biosystems^™, Foster City, CA, USA). cDNA samples were diluted to a concentration of 5 ng µl⁻¹. Primers were diluted to a stock of 5 µM. Real-Time PCR was conducted using 10 ng cDNA, 1×  SYBR Green I (Invitrogen^™), 150 nM forward and reverse primer:

• GAPDH (F-GGAAGCATAAGAACATCGGAACTG, R-GGAGTGGGTGTCGCTGTTG),
• HPRT1 (F-TGACACTGGCAAAACAATGCA, R-GGTCCTTTTCACCAGCAAGCT),
• MAPK7 (F-CAGAGTCACCTGATGTCAACCTT, R-GGGTCCTCCACCTGTGACT),
• BCL2 (F-GGTGAACTGGGGGAGGATTGT, R-CTTCAGAGACAGCCAGGAGAA),
• CHEK1 (F-TTGTGAGCAGCCAGAAGATTT, R-GCAGCACTATATTCACCAGGATT),
• CHOP (F- TGCTTCTCTGGCTTGGCTGAC, R-CCGTTTCCTGGTTCTCCCTTGG).

All reactions were performed on a standard run for 2 h using the following program: Denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Finally, melting curves of the amplicons were acquired by heating the samples for 15 s–95 °C, and for 1 min to 60 °C. The relative expression was determined using the comparative ΔΔt-method and qBase  +  software (Biogazelle). Reference genes GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) and HPRT1 (Hypoxanthine phosphoribosyl-transferase I) were selected from a list of 10 reference targets using the geNorm algorithm.

To determine the change in properties of PTM and PTW after exposure to CAP, the pH and the concentrations of H₂O₂ and ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ were measured at different exposure times and dilutions. As demonstrated in figure 1(b), after 10 min of treatment, there was a drastic decrease in the pH of PTW, while only a small increase in pH was observed for PTM. After the addition of PTM/PTW-50, 25, 12.5 and 6.2 to the cell culture media, a slight reduction in the pH was observed after addition of PTW-50 to the media, but in all other cases there was no change in pH (figure 1(c)). Therefore, to avoid the effect of pH on cell toxicity, we did not use PTW-50 in our further experiments.

Zoom In Zoom Out Reset image size

As shown in figures 1(d) and (e), the ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ and H₂O₂ concentrations generally increased upon longer CAP treatment times in both PTM and PTW, although the increase in ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ concentration in PTW was not very pronounced. At 3 and 5 min of treatment time, both the ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ and H₂O₂ concentrations were somewhat higher in PTW than in PTM. This might be because upon increasing plasma treatment more and more ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ is converting to ${\rm N}{{{\rm O}}_{{{3}^{-}}}}$, or to other reaction products due to a reaction of short-lived radicals with ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$, and therefore the concentration of ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ decreases. On the other hand, in PTM less ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ is converting to ${\rm N}{{{\rm O}}_{{{3}^{-}}}}$ or other products, because the short-lived radicals that would react with ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ may react faster with the amino acids/proteins in the PTM, resulting in more ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ in PTM. However, the concentration of H₂O₂ is clearly much higher than the ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ concentration in all treatment conditions, and similar trends were also reported in a previous study [11].

Recently, Van Boxem et al [11] demonstrated that for a small gap (i.e. the distance between the plasma device outlet and PBS solution) and high gas flow rates of feeding gas, the concentration of H₂O₂ is high as compared to the ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ concentration; because at this condition, a large fraction of gaseous OH radicals reaches the liquid, resulting in a higher H₂O₂ concentration in the liquid. However, at a large gap and low flow rates of feeding gas, the concentration of H₂O₂ is comparable to ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$, because many of the gaseous OH radicals will readily recombine in the gas phase and a lower amount of H₂O₂ reaches the liquid surface. On the other hand, most N-species (such as NO or NO₂) reach the liquid phase, because their gas density is much higher than that of the O-species, as 80% of ambient air consists of N₂. In this study we also used high gas flow rates and a small gap, yielding a high H₂O₂ concentration compared with the ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ concentration, which is in good agreement with [11].

The MTT assay was used to determine the cell viability of PTM and PTW treated pancreatic cancer cells (Miapaca-2, Bxpc3) and human PSCs (hPSC128-SV). For untreated controls, the same percentages of non-treated media (NTM) and DI water (NTW) were added. As shown in figure 2, all three cell lines demonstrated a slight decrease in viability after treatment with PTM/PTW-3.1, but the reduction in viability was quite pronounced for PTM/PTW-25, PTM/PTW-12.5 and PTM/PTW-6.2, after incubation for 24, 48, and 72 h, certainly in comparison with NTM and NTW. The addition of NTW-25 decreased the cell viability to some extent for all three studied cell lines, due to dilution of the culture media (see figure 2).

Zoom In Zoom Out Reset image size

When comparing the effects on the three different cell lines, we observed a cytotoxicity of  ≈85%, after treatment of the Miapaca-2 and Bxpc3 cells with PTM/PTW-25 while at the same concentration of PTM/PTW treatment of the hPSC128-SV cells only  ≈60% cytotoxicity was observed after 24 h of incubation, as shown in figure 2(c). This demonstrates that the hPSC128-SV cells, which are responsible for the strong desmoplastic reaction (i.e. PSC cells are associated with pancreatic tumors and they closely interact with cancer cells to create a tumor-promoting environment that stimulates local tumor progression and metastasis), are more resistant. However, when the incubation time increases to 48 and 72 h, about 70% and 80% of the hPSC128-SV cells are dead, respectively, as well as more than 90% of the Miapaca-2 and Bxpc3 cells.

When comparing the effects of PTM and PTW, it is clear that they generally have a similar killing capacity for the Miapaca-2 and Bxpc3 cancer cells, with sometimes PTW being more effective and sometimes vice versa. However, PTW seems to be slightly more effective in deactivating the hPSC128-SV cells than PTM. Thus, our results show that the cell killing capacity of PTM is not due to a modification in proteins/amino acids after plasma treatment of the medium, but rather due to the presence of RONS in the liquid, as in PTW.

To determine the role of H₂O₂ on the viability of Miapaca2, Bxpc3 and hPSC128-SV cells, we treated these cell lines with different concentrations of H₂O₂ and incubated them for 24 and 48 h, as shown in figure 3. The viability of the cancer cells after 100 µM of H₂O₂ treatment was 85, 80 and 81% for the Miapaca2, Bxpc3 and hPSC128-SV cells, respectively, after 24 h of incubation (figure 3). We added different percentages (25, 12.5, 6.2, 3.1 and 1.5%) of PTM/PTW to the culture media (untreated) with cells, to obtain a final volume of 500 µl in each well, as described above, thus yielding H₂O₂ concentrations of 225 µM, 112.5 µM, 55.8 µM, 22.9 µM and 13.5 µM, respectively. The calculation of the final H₂O₂ concentrations present in the total cell media (500 µl) was described in the Methodology section. When comparing the viability of the above-mentioned cancer cells after treatment with PTM/PTW-12.5 (yielding a H₂O₂ concentration of 112.5 µM), we observed approximately 25% viability in the Miapaca-2 and Bxpc3 cells, and approximately 40% cell viability in the hPSC128-SV cells (see figure 2), which is much lower than the viability of ca. 80%–85% after direct treatment with 100 µM of H₂O₂ (see figure 3). Hence, we can conclude that the PTM/PTW action was stronger and was not only due to the H₂O₂ effect.

Zoom In Zoom Out Reset image size

Additionally, we tried to minimize the effects of osmotic-pressure change. Therefore, our experimental data (figure 2) was based on the comparative study with different percentages of non-plasma treated media and water (NTM/NTW). We found only 10%–15% cell death for the 25% non-PTW, while in the other treatment conditions, i.e. 12.5, 6.2, 3.1 and 1.5% non-PTW, we did not find any cell death. Hence, there was only a slight effect of the osmotic-pressure with the addition of 25% non-PTW. To avoid the effect of osmotic pressure caused by PTW, we used 12.5% of PTW in our experiments, as discussed below.

Furthermore, we also analysed the degree of apoptosis/necrosis after treatment of all three cell types. For this purpose, we incubated the cells with PTM/PTW-12.5 for 3 h, after which the cells were harvested, and stained with annexin V-FITC/PI. The majority of dead cells stained both annexin V-FITC and PI, indicating that the PTM/PTW-treated non-viable cells were mostly late apoptotic or necrotic. In late apoptosis, loss of membrane integrity will allow PI to intercalate to DNA (Annexin V positive, PI positive) and in the necrotic process, the membrane integrity is lost and PI will intercalate to DNA (Annexin V negative, PI positive). However, Annexin V will enter this permeated cell membrane in necrosis in order to bind to PS on the inner cell membrane (Annexin V positive, PI positive). Therefore, in the current experimental setup, Annexin V and PI positive staining represents late apoptotic combined with necrotic cell death [12, 39].. As shown in figure 4, for Miapaca-2, PTM-12.5 induced  ≈80% late apoptosis/necrosis (Annexin V positive, PI positive), while PTW-12.5 induced  ≈70% late apoptosis/necrosis (figure 4(d)). For Bxpc3, PTM-12.5 induced  ≈70% late apoptosis/necrosis, while PTW-12.5 induced  ≈65% late apoptosis/necrosis, (figure 4(e)). Finally, for the hPSC128-SV cells, PTM-12.5 induced only  ≈40% late apoptosis/necrosis, and PTW-12.5 induced  ≈60% late apoptosis/necrosis, (figure 4(f)). Again, these results indicate that PTW action on hPSC128-SV is stronger than PTM, as shown in figure 2.

Zoom In Zoom Out Reset image size

Taken together, these results demonstrate that CAP treated media and DI water can induce apoptosis/necrosis in pancreatic cancer cells, and also in chemo-resistant stellate cells. The H₂O₂ solutions (100 µM) also induce  ≈25% late apoptosis/necrosis in the Miapaca-2 and Bxpc3 cell lines, while in the hPSC128-SV cells  ≈30% late apoptosis/necrosis was observed. As this is lower than the effects of PTW and PTM, this also demonstrates that the reduction in cancer cell viability was not only due to the presence of H₂O₂, but that it was a combined effect of various RONS that were produced in the PTM/PTW, which eventually influence intracellular redox signaling through enhancement of intracellular ROS.

The intracellular ROS levels were estimated using fluorescent probes. The intensity of the CellROX^™ Green probe, used to detect the intracellular ROS content, dramatically increased upon addition of PTM/PTW-12.5, and a higher fluorescence intensity was detected for all three treated cell lines in comparison with the control, as shown in figure 5. The enhancement of the intracellular ROS content might be due to the CAP generated extracellular RONS. In turn, the increase in intracellular ROS content would result in higher oxidative stress inside the cell, and this could modulate several protein signaling pathways, such as the apoptotic pathway [40].

Zoom In Zoom Out Reset image size

To better understand the latter effects, we evaluated the mRNA expression profiles of four oxidative stress and apoptotic-related genes, i.e. MAPK7, BCL2, CHEK1 and CHOP, as shown in figure 6. MAPK7 has been suggested to be a potential tumor biomarker for many cancers, as an abnormal upregulation of MAPK7 is involved in cell proliferation and metastasis in several types of cancer [41]. Furthermore, the BCL2 family of proteins are one of the key regulators of cell death by apoptosis [42, 43] and a high expression of BCL2 mediates the resistance of various cancers to a wide range of chemotherapeutic drugs and γ-irradiation [42]. Therefore, downregulation of MAPK7 and BCL2 can restore the apoptotic process in tumor cells. CHEK1 plays an essential role in the cell cycle checkpoint response following DNA damage, and targeting these regulators by inhibition or depletion would sensitize cancer cells to chemotherapy [44, 45]. Hence, downregulation of CHEK1 induces double-stranded DNA breaks and chromosomal fragmentation in cancer cells. Finally, expression of CHOP is upregulated under endoplasmic reticulum (ER) stress and this would also lead to apoptosis [46]. In our study, the PTM/PTW treatment (see figure 5) downregulated the expression of the tumor biomarkers, MPK7, BCL2 and CHEK1 in all three pancreatic cells (see figure 6), which could explain the increase in cell death. This is in agreement with previous reports [39–44]. However, the expression of CHOP did not change significantly upon PTM/PTW treatment.

Zoom In Zoom Out Reset image size

Based on previous reports, the major effects from plasma exposure were found to be the activation of oxidative mediated pathways such as MAPK and p53 signaling pathways, resulting in changes in apoptosis related gene expression [47]. Additionally, antioxidant machinery such as nrf2-involved in regulation of heme oxygenase 1, and NADPH-quinone oxidoreductase [48]. Some previous studies have shown that oxidative stress elicits cancer cell death through the inactivation of MAPK7, CHEK1 and BCL2 expression [41–44]. It could be likely that PTM/PTW plays a major role in initiating cell death in pancreatic cancer cells (Miapaca-2 and Bxpc3), as well as in the chemo-resistant human PSCs (hPSC128-SV) through down regulation of MAPK7, BCL2 and CHEK1 gene expression, and also oxidative stress mediated pathways.

The above mentioned experimental results demonstrate that the treatment of pancreatic ductal adenocarcinomas and PSCs by PTM/PTW deactivates these cells, but the deactivation strongly depends on the concentrations of PTM/PTW used. PTM/PTW mainly consists of long-lived species, such as H₂O₂, ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ and ${\rm N}{{{\rm O}}_{{{3}^{-}}}}$, and among them H₂O₂ and ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ are of main interest for cancer cell death [49–51]. Some studies have shown that the action of PTL against cancer cells is most likely as H₂O₂ treatment [52], whereas in other studies it was reported that the presence of both ROS and RNS in PTL are responsible for cancer cell death [49, 53]. It was also reported that the long lifetime species such as H₂O₂ and ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ fully account for the toxicity of plasma [49–51]: H₂O₂ seems to play a key role in cell death, but the production of ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ along with H₂O₂ increases the toxicity [49–51, 53]. The presence of H₂O₂ and ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ in PTM/PTW leads to the generation of ONOO⁻ [49, 54], which has a high potential to kill cancer cells [55]. On the other hand, Bauer recently suggested that singlet oxygen is the main component of cell death in PTM treatment [51]. It is generated by a complex reaction between ONOO⁻ and H₂O₂ [51]. The above studies show that the cytotoxicity of PTM/PTW is not only due to the H₂O₂ effect, but that it is a combined effect of H₂O₂ and ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$, which results in many direct and indirect reactions taking place during PTM/PTW treatment. Our study also demonstrates that H₂O₂ is not the only factor for cancer cell death, but that it could be a combination of H₂O₂ and ${\rm N}{{{\rm O}}_{{{2}^{-}}}}$ effects.